Difference between revisions of "ABC-INT-Genome annotation"

From "A B C"
Jump to navigation Jump to search
m
m
Line 37: Line 37:
  
  
{{HOLD}}
 
  
 
{{Smallvspace}}
 
{{Smallvspace}}
Line 48: Line 47:
  
 
=== Evaluation ===
 
=== Evaluation ===
This "Integrator Unit" should be submitted for evaluation for a maximum of 8 marks if one of the written deliverables is chosen, resp. 16 marks for the oral test<ref>Note: the oral test will focus on the unit content but will also cover other material that leads up to it.</ref>.
+
This "Integrator Unit" should be submitted for evaluation for a maximum of 13 marks if one of the written deliverables is chosen, resp. 24 marks if you choose this for your oral test<ref>Note: the oral test is cumulative. It will focus on the content of this unit but will also cover other material that leads up to it.</ref>.
:Please note the evaluation types that are available as options for this unit. Choose one evaluation type that you have not chosen for another Integrator Unit. (Each submitted Integrator Unit must be evaluated in a different way and one of your evaluations - but not your first one - must be an oral test).
+
:Please note the evaluation types that are available as options for this unit.
 +
:Be mindful of the [[ABC-Rubrics| '''Marking rubrics''']].
 +
:If this is submitted for your oral test, please read the [[BCH441 Oral Test instructions|Oral test instructions]] before you begin.
 +
:If your submission includes R code, please read the [[BCH441 Code submisson instructions|Code submission instructions]] before you begin.
 +
 
 +
Once you have chosen an option ...
 +
<ol>
 +
<li>Create a new page on the student Wiki as a subpage of your User Page.</li>
 +
<li>Put all of your writing to submit on this one page.</li>
 +
 
 +
<li>When you are done with everything, go to the [https://q.utoronto.ca/courses/180416/assignments Quercus '''Assignments''' page] and open the appropriate '''Integrator Unit''' assignment. Paste the URL of your Wiki page into the form, and click on '''Submit Assignment'''.</li>
 +
</ol>
 +
 
 +
'''Do not''' change your Wiki page after you have submitted your assignment, until it has been graded.
 +
 
 
{{Smallvspace}}
 
{{Smallvspace}}
<!--
+
 
 
;Report option
 
;Report option
* Work through the tasks described in the scenario.
+
* Work through the tasks described below.
* Document your results in a short report on a subpage of your User page on the Student Wiki. Describe your methods (R-code!) in an appendix;
+
* Document your results in a short technical report on a subpage of your User page on the Student Wiki. Describe your methods (R-code!) in [[BCH441 Code submisson instructions|an appendix]] linked from your report;
* When you are done with everything, add the following category tag '''to the end of page''':
+
* When you are done, submit the link to your page via Quercus as described above.
::<code><nowiki>[[Category:EVAL-INT-Genome_annotation]]</nowiki></code>.
 
  
Once the page has been saved with this tag, it is considered "submitted".
 
'''Do not''' change your submission after this tag has been added. The page will be marked and the category tag will be removed by the instructor.
 
 
{{Smallvspace}}
 
{{Smallvspace}}
-->
+
 
 +
<!--
 
;Interview option
 
;Interview option
 
: Identify a laboratory whose work includes genome annotation, or re-annotation. Get in touch with the PI, a postdoc or senior graduate student in the laboratory and interview them in person or by eMail. Find out
 
: Identify a laboratory whose work includes genome annotation, or re-annotation. Get in touch with the PI, a postdoc or senior graduate student in the laboratory and interview them in person or by eMail. Find out
Line 77: Line 88:
 
Once the page has been saved with this tag, it is considered "submitted".
 
Once the page has been saved with this tag, it is considered "submitted".
 
'''Do not''' change your submission after this tag has been added. The page will be marked and the category tag will be removed by the instructor.
 
'''Do not''' change your submission after this tag has been added. The page will be marked and the category tag will be removed by the instructor.
 +
-->
 
{{Smallvspace}}
 
{{Smallvspace}}
 +
 
;Literature research option
 
;Literature research option
 
:This option requires that a primary publication is available for the MYSPE genome sequence; if there is none, this option is not available.
 
:This option requires that a primary publication is available for the MYSPE genome sequence; if there is none, this option is not available.
:* Write a report on the annotation methodology that was used for the MYSPE genome. Note: this is not a review, but a report. Think of a "whitepaper", not a publication. Write to a specialist technical audience - imagine collaborators who want to use the same methods - and be specific to provide actionable information.
+
:* Write a report on the annotation methodology that was used for the MYSPE genome. Note: this is not a review, but a report. Think of a "whitepaper", not a publication. Write to a specialist technical audience - imagine collaborators who want to use the same methods - and be specific to provide actionable information (links, instructions, resource requirements ...).
 +
:* Include a sketch of the workflow;
 
:* write your report on a subpage of your User page of the Student Wiki;
 
:* write your report on a subpage of your User page of the Student Wiki;
 
:* make sure that you have included all references and citations.
 
:* make sure that you have included all references and citations.
:* When you are done with everything, add the following category tag '''to the end of page''':
+
:* the level of detail should be sufficient to allow an undergraduate project student to reproduce the analysis.
::<code><nowiki>[[Category:EVAL-INT-Genome_annotation]]</nowiki></code>.
+
* When you are done, submit the link to your page via Quercus as described above.
  
Once the page has been saved with this tag, it is considered "submitted".
 
'''Do not''' change your submission after this tag has been added. The page will be marked and the category tag will be removed by the instructor.
 
 
{{Smallvspace}}
 
{{Smallvspace}}
 +
 
;Oral test option
 
;Oral test option
* Work through the tasks described in the scenario. Remember to document your work in your journal.
+
* Work through the tasks described below. Remember to document your work in your journal, but there is no need to format this specially as a report.
* Part of your task will involve writing an R script, place that code in a subpage of your User page on the Student Wiki and link to it from your Journal. (Do not add an evaluation category tag to that code).
+
* Part of your task will involve writing an R script; refer to the [[BCH441 Code submisson instructions|Code submission instructions]] and link to your page from your Journal.
* Your work must be complete before 21:00 on the day before your exam.
+
* Note that the work must be completed [[BCH441 Oral Test instructions| '''before''' your actual test date.]]
* Schedule an oral test by editing the [http://steipe.biochemistry.utoronto.ca/abc/students/index.php/Signup-BCH441_Oral_tests '''signup page on the Student Wiki''']. Enter the unit that you are signing up for, and your name. You must have signed-up for an exam slot before 21:00 on the day before your exam.
+
 
 
{{Smallvspace}}
 
{{Smallvspace}}
 +
<!--
 
;Genome sequence analysis option
 
;Genome sequence analysis option
 
* Start a subpage of your User page on the Student Wiki to document your analysis;
 
* Start a subpage of your User page on the Student Wiki to document your analysis;
 
* Work through the tasks described in the scenario, download sequence data and develop an analysis script as required. Keep your script generic, so that you could easily adapt it to analyze a different gene. Keep careful Journal notes of your activities with your analysis.
 
* Work through the tasks described in the scenario, download sequence data and develop an analysis script as required. Keep your script generic, so that you could easily adapt it to analyze a different gene. Keep careful Journal notes of your activities with your analysis.
* When you are done with everything, add the following category tag '''to the end of page''':
+
* ...
::<code><nowiki>[[Category:EVAL-INT-Genome_annotation]]</nowiki></code>.
+
-->
  
Once the page has been saved with this tag, it is considered "submitted".
 
'''Do not''' change your submission after this tag has been added. The page will be marked and the category tag will be removed by the instructor.
 
 
== Contents ==
 
== Contents ==
 +
 
{{Smallvspace}}
 
{{Smallvspace}}
 +
 
===Scenario===
 
===Scenario===
 +
 
{{Smallvspace}}
 
{{Smallvspace}}
You know that MYSPE has an Mbp1 orthologue. The key questions of functional genome annotation would be: does it work in the same way in MYSPE as in yeast? Does it have the same target genes? Is it regulated by orthologues to other yeast genes that imply the same feedback mechanisms and genetic regulatory circuits? Here we will try to deduce just one part of such questions: is the binding motif for Mbp1 conserved? If that is the case, we could automate the task to find genes that are potentially regulated by MBP1_MYSPE, if not, we would need to pursue a different strategy of binding site discovery.
 
  
Here is how we assess the conservation of the Mbp1 DNA binding motif in MYSPE, working from the orthologue of  CDC6, a pre-replicative complex component:
+
You know that MYSPE has an Mbp1 orthologue. Key questions of functional genome annotation could be: does it work in the same way in MYSPE as in yeast? Does it have the same target genes? Is it regulated by orthologues to other yeast genes that imply the same feedback mechanisms and genetic regulatory circuits? Here we will try to deduce just one part of such questions: is the binding motif for Mbp1 conserved? If that is the case, we could automate the task to find genes that are potentially regulated by MBP1_MYSPE, if not, we would need to pursue a different strategy of binding site discovery.
* Find the MYSPE orthologue for yeast CDC6.
+
 
* Fetch 500 nucleotides of upstream genome sequence. (Demonstrate that this is the correct sequence by showing the first 10 translated CDC6 codons with your sequence.)
+
Here is how we assess the conservation of the Mbp1 DNA binding motif in MYSPE, working from the orthologue of  CDC6, a pre-replicative complex component that is one of Mbp1's target genes:
* The yeast Mbp1 canonical binding site is defined by the regular expression <tt>[AT]CGCG[AT]</tt>.
+
* Find the MYSPE orthologue for yeast CDC6 and '''document''' your search and result.
 +
* Fetch 500 nucleotides of upstream genome sequence. (Demonstrate that this is the correct sequence by showing the first 10 translated CDC6 codons with your sequence.) Make sure that you are reverse complementing the sequence in case your orthologue is transcribed from the (-)-strand.<ref>Please note: if you can't demonstrate that you are working with the correct sequence, there is no point in continuing to search for putative binding motifs. Even if you would find one, that would be meaningless, because it would be in the wrong context. Please resist any temptation to edit or otherwise manipulate the sequence: that would be an academic offence. The sequence you show must be exactly the sequence you have downloaded from the database, and your links must work and produce exactly the correct sequence. If you can't get this to work, contact me to resolve this.</ref>
 +
* Precisely demonstrate that this is the correct sequence by including the same information as in the sample annotation below. In particular
 +
** There must be ten lines of 50 nucleotides each;
 +
** There must be ten codons on the next line;
 +
** therefore the download link must span exactly 530 nucleotides;
 +
** The first of the ten codons must be a start codon, and you show the translation;
 +
** There must be a link to the genome sequence source (with chromosomal coordinates)
 +
** There must be a link to the protein sequence and it must start with the translated amino acids;
 +
** The motifs you find and discuss must be indicated in the annotated sequence listing.
 +
* The yeast Mbp1 canonical binding site is defined by the regular expression <tt>"[AT]CGCG[AT]"</tt>. (Please review [[RPR-RegEx]] if you are not sure about the meaning of "[" and "." in a regular expression.)
 
* Are there <tt>CGCG</tt> motifs present in your nucleotide sequence?
 
* Are there <tt>CGCG</tt> motifs present in your nucleotide sequence?
* Identify them using a regular expression search. You may find the following code useful:
+
* Identify them using a regular expression search. Refer to [[RPR-RegEx]] to review the use of <tt>gregexpr()</tt> and <tt>regmatches()</tt>. The folowing code-sample may get you started:
<source lang="R">
+
 
 +
<pre>
 
patt <- "..CGCG.."
 
patt <- "..CGCG.."
 
m <- gregexpr(patt, mySeq)
 
m <- gregexpr(patt, mySeq)
 
regmatches(mySeq, m)[[1]]
 
regmatches(mySeq, m)[[1]]
</source>
+
</pre>
 +
 
 
* Are there <tt>[AT]CGCG</tt> or <tt>CGCG[AT]</tt> motifs? What about <tt>[AT]CGCG[AT]</tt>?
 
* Are there <tt>[AT]CGCG</tt> or <tt>CGCG[AT]</tt> motifs? What about <tt>[AT]CGCG[AT]</tt>?
* Where are they located? Do they cluster? Are they arranged in a similar way as the yeast binding sites that you visited at UCSC?
+
* Where are the motifs located? Do they cluster? Are they arranged in a similar way as the yeast binding sites that you visited at UCSC?
* Interpret your finding. Does this support or refute the idea that MBP1_MYSPE has the same DNA sequence binding specificity as MBP1_SACCEE?
+
* Interpret your finding by contarsting your observation to the situation with yeast. Does ypur analysis support or refute the idea that MBP1_MYSPE has the same DNA sequence binding specificity as MBP1_SACCE?
  
 
{{Vspace}}
 
{{Vspace}}
  
== Self-evaluation ==
+
=== Sample annotation ===
<!--
+
 
=== Question 1===
+
;(Demonstrating the required level of detail for a valid submission:)
 +
 
 +
* MYSPE: ''Sporothrix Schenckii'' ([https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?&id=1397361 1397361])
 +
* [https://www.yeastgenome.org/locus/S000003730 CDC6] ([https://www.ncbi.nlm.nih.gov/protein/NP_012341 NP_012341]) orthologue (by RBM): [https://www.ncbi.nlm.nih.gov/protein/XP_016592126 XP_016592126] (coverage: 72%; E: 4e-27; ID: 26.08%) (Reverese search in taxID:4932 finds NP_012341)
 +
* [https://www.ncbi.nlm.nih.gov/protein/XP_016592126.1?report=fasta Protein FASTA of XP_016592126]
 +
* <tt>ATG</tt>: 1255377 .. 1255379
 +
* [https://www.ncbi.nlm.nih.gov/nuccore/NW_015971139.1?report=fasta&from=1254877&to=1255406 Link to Genomic sequence (FASTA)] (Range: 1254877..1255406)
 +
 
 +
<pre>
 +
>ref|NW_015971139.1|:1254877-1255406 Sporothrix schenckii 1099-18 chromosome Unknown Cont38, whole genome shotgun sequence
 +
 
 +
  5'-TCCACCAAACTAGTCGGGCGAGCTGAACTATGTCGTCCGCCATTTAAAGC
 +
 
 +
    CCACTGTACGAATAGCGCAATACTGTAGACGACCGCACAGTGTATCTGTG
 +
 
 +
    GCTAGTGTGCAAGCACGCGCCACGGCAGCTGGGCGGGTCTGGGGTCAATC
 +
                  =====x
 +
    CTCCCACGTACGCGTAAAACCGCCAACGCGTCCAGCAATGGCAGGGGTAA
 +
              ======
 +
    GTCAGTCGCGCTTTCTTCGCGTAAAGTGGTTCCTCTATTTGGCGCGCGCT
 +
          =====x
 +
    TCCTCATTAAATCTTGTACCTCCCTTGGCCACCATCTTGAACTTTCCTTC
 +
 
 +
    GTGCTTTCCACGTTTGACTTCATTCCCTGTTACTTCCATTTTGTCCATTC
 +
 
 +
    TTGCGACTGTCTATTCTTTCTTTGCGAGCATCTACGCATCTATCCATCGT
 +
 
 +
    TCTTTCCGTTGTATGCATCTACGTCGCTGTTCTTGCCATTGCTTTACCCC
  
Question ...
+
    TTTCTTTAAACCCTTCCTCCTTTGCTCTTTCCTCACCACACACTACAAAC
  
<div class="toccolours mw-collapsible mw-collapsed" style="width:800px">
+
    ATG GTT GCT TCC TCG CTC GGA AAG CGG ATC.....      -3'
Answer ...
+
      M  V  A  S  S  L  G  K  R  I  ...
<div class="mw-collapsible-content">
+
</pre>
Answer ...
 
  
</div>
 
  </div>
 
  
  {{Vspace}}
 
  
-->
 
== Further reading, links and resources ==
 
<!-- {{#pmid: 19957275}} -->
 
<!-- {{WWW|WWW_GMOD}} -->
 
<!-- <div class="reference-box">[http://www.ncbi.nlm.nih.gov]</div> -->
 
 
== Notes ==
 
== Notes ==
 
<references />
 
<references />
Line 161: Line 205:
 
:2017-08-05
 
:2017-08-05
 
<b>Modified:</b><br />
 
<b>Modified:</b><br />
:2018-12-18
+
:2020-10-01
 
<b>Version:</b><br />
 
<b>Version:</b><br />
:1.0.1
+
:1.1
 
<b>Version history:</b><br />
 
<b>Version history:</b><br />
 +
*1.1 2020 Updates; add example annotated sequence.
 
*1.0.1 Capitalize CDC6
 
*1.0.1 Capitalize CDC6
 
*1.0 First live version
 
*1.0 First live version
Line 174: Line 219:
 
[[Category:ABC-units]]
 
[[Category:ABC-units]]
 
{{INTEGRATOR}}
 
{{INTEGRATOR}}
{{HOLD}}
+
{{LIVE}}
 
{{EVAL}}
 
{{EVAL}}
 
</div>
 
</div>
 
<!-- [END] -->
 
<!-- [END] -->

Revision as of 10:35, 1 October 2020

Integrator Unit: Genome annotation

(Integrator unit: annotate sequences in a genome)


 


Abstract:

This page assesses the learning units for data management and sequence analysis of genomic sequence data.


Deliverables:

  • Integrator unit: Deliverables can be submitted for course marks. See below for details.

  • Prerequisites:
    This unit builds on material covered in the following prerequisite units:


     



     



     


    Evaluation

    This "Integrator Unit" should be submitted for evaluation for a maximum of 13 marks if one of the written deliverables is chosen, resp. 24 marks if you choose this for your oral test[1].

    Please note the evaluation types that are available as options for this unit.
    Be mindful of the Marking rubrics.
    If this is submitted for your oral test, please read the Oral test instructions before you begin.
    If your submission includes R code, please read the Code submission instructions before you begin.

    Once you have chosen an option ...

    1. Create a new page on the student Wiki as a subpage of your User Page.
    2. Put all of your writing to submit on this one page.
    3. When you are done with everything, go to the Quercus Assignments page and open the appropriate Integrator Unit assignment. Paste the URL of your Wiki page into the form, and click on Submit Assignment.

    Do not change your Wiki page after you have submitted your assignment, until it has been graded.


     
    Report option
    • Work through the tasks described below.
    • Document your results in a short technical report on a subpage of your User page on the Student Wiki. Describe your methods (R-code!) in an appendix linked from your report;
    • When you are done, submit the link to your page via Quercus as described above.


     


     
    Literature research option
    This option requires that a primary publication is available for the MYSPE genome sequence; if there is none, this option is not available.
    • Write a report on the annotation methodology that was used for the MYSPE genome. Note: this is not a review, but a report. Think of a "whitepaper", not a publication. Write to a specialist technical audience - imagine collaborators who want to use the same methods - and be specific to provide actionable information (links, instructions, resource requirements ...).
    • Include a sketch of the workflow;
    • write your report on a subpage of your User page of the Student Wiki;
    • make sure that you have included all references and citations.
    • the level of detail should be sufficient to allow an undergraduate project student to reproduce the analysis.
    • When you are done, submit the link to your page via Quercus as described above.


     
    Oral test option
    • Work through the tasks described below. Remember to document your work in your journal, but there is no need to format this specially as a report.
    • Part of your task will involve writing an R script; refer to the Code submission instructions and link to your page from your Journal.
    • Note that the work must be completed before your actual test date.


     

    Contents

     

    Scenario

     

    You know that MYSPE has an Mbp1 orthologue. Key questions of functional genome annotation could be: does it work in the same way in MYSPE as in yeast? Does it have the same target genes? Is it regulated by orthologues to other yeast genes that imply the same feedback mechanisms and genetic regulatory circuits? Here we will try to deduce just one part of such questions: is the binding motif for Mbp1 conserved? If that is the case, we could automate the task to find genes that are potentially regulated by MBP1_MYSPE, if not, we would need to pursue a different strategy of binding site discovery.

    Here is how we assess the conservation of the Mbp1 DNA binding motif in MYSPE, working from the orthologue of CDC6, a pre-replicative complex component that is one of Mbp1's target genes:

    • Find the MYSPE orthologue for yeast CDC6 and document your search and result.
    • Fetch 500 nucleotides of upstream genome sequence. (Demonstrate that this is the correct sequence by showing the first 10 translated CDC6 codons with your sequence.) Make sure that you are reverse complementing the sequence in case your orthologue is transcribed from the (-)-strand.[2]
    • Precisely demonstrate that this is the correct sequence by including the same information as in the sample annotation below. In particular
      • There must be ten lines of 50 nucleotides each;
      • There must be ten codons on the next line;
      • therefore the download link must span exactly 530 nucleotides;
      • The first of the ten codons must be a start codon, and you show the translation;
      • There must be a link to the genome sequence source (with chromosomal coordinates)
      • There must be a link to the protein sequence and it must start with the translated amino acids;
      • The motifs you find and discuss must be indicated in the annotated sequence listing.
    • The yeast Mbp1 canonical binding site is defined by the regular expression "[AT]CGCG[AT]". (Please review RPR-RegEx if you are not sure about the meaning of "[" and "." in a regular expression.)
    • Are there CGCG motifs present in your nucleotide sequence?
    • Identify them using a regular expression search. Refer to RPR-RegEx to review the use of gregexpr() and regmatches(). The folowing code-sample may get you started:
    patt <- "..CGCG.."
    m <- gregexpr(patt, mySeq)
    regmatches(mySeq, m)[[1]]
    
    • Are there [AT]CGCG or CGCG[AT] motifs? What about [AT]CGCG[AT]?
    • Where are the motifs located? Do they cluster? Are they arranged in a similar way as the yeast binding sites that you visited at UCSC?
    • Interpret your finding by contarsting your observation to the situation with yeast. Does ypur analysis support or refute the idea that MBP1_MYSPE has the same DNA sequence binding specificity as MBP1_SACCE?


     

    Sample annotation

    (Demonstrating the required level of detail for a valid submission
    )
    >ref|NW_015971139.1|:1254877-1255406 Sporothrix schenckii 1099-18 chromosome Unknown Cont38, whole genome shotgun sequence
    
      5'-TCCACCAAACTAGTCGGGCGAGCTGAACTATGTCGTCCGCCATTTAAAGC
    
         CCACTGTACGAATAGCGCAATACTGTAGACGACCGCACAGTGTATCTGTG
    
         GCTAGTGTGCAAGCACGCGCCACGGCAGCTGGGCGGGTCTGGGGTCAATC
                       =====x
         CTCCCACGTACGCGTAAAACCGCCAACGCGTCCAGCAATGGCAGGGGTAA
                  ======
         GTCAGTCGCGCTTTCTTCGCGTAAAGTGGTTCCTCTATTTGGCGCGCGCT
              =====x
         TCCTCATTAAATCTTGTACCTCCCTTGGCCACCATCTTGAACTTTCCTTC
    
         GTGCTTTCCACGTTTGACTTCATTCCCTGTTACTTCCATTTTGTCCATTC
    
         TTGCGACTGTCTATTCTTTCTTTGCGAGCATCTACGCATCTATCCATCGT
    
         TCTTTCCGTTGTATGCATCTACGTCGCTGTTCTTGCCATTGCTTTACCCC
    
         TTTCTTTAAACCCTTCCTCCTTTGCTCTTTCCTCACCACACACTACAAAC
    
         ATG GTT GCT TCC TCG CTC GGA AAG CGG ATC.....      -3'
          M   V   A   S   S   L   G   K   R   I   ...
    


    Notes

    1. Note: the oral test is cumulative. It will focus on the content of this unit but will also cover other material that leads up to it.
    2. Please note: if you can't demonstrate that you are working with the correct sequence, there is no point in continuing to search for putative binding motifs. Even if you would find one, that would be meaningless, because it would be in the wrong context. Please resist any temptation to edit or otherwise manipulate the sequence: that would be an academic offence. The sequence you show must be exactly the sequence you have downloaded from the database, and your links must work and produce exactly the correct sequence. If you can't get this to work, contact me to resolve this.


     


    About ...
     
    Author:

    Boris Steipe <boris.steipe@utoronto.ca>

    Created:

    2017-08-05

    Modified:

    2020-10-01

    Version:

    1.1

    Version history:

    • 1.1 2020 Updates; add example annotated sequence.
    • 1.0.1 Capitalize CDC6
    • 1.0 First live version
    • 0.1 First stub

    CreativeCommonsBy.png This copyrighted material is licensed under a Creative Commons Attribution 4.0 International License. Follow the link to learn more.